DNA to Protein Translation

This project reads nucleotide sequences from a FASTA file, finds all ATG start codons, and translates each open reading frame (ORF) into an amino acid sequence until a stop codon or the end of the sequence is reached.

Features

• Handles multiple sequences in one FASTA file
• Finds all ATG start codons
• Stops translation at TAA, TAG, or TGA codons
• Outputs translated sequences in FASTA format

Requirements

• Python 3.x

Usage

1. Place your nucleotide sequences in a FASTA file, e.g., input.fasta.
2. Run the Python script:

python genetic_translation.py -i input.fasta -o output.fasta

3. The translated protein sequences will be saved in output.fasta.

Example Input

>seq1
CGCGATATGCATGTACTAATATAAGATGATAATCA

Example Output

>seq1-6
MHVLI
>seq1-10
MY
>seq1-25
MII

Notes

• Each sequence in the output FASTA file is named with the input sequence name, followed by the zero-based start position of the ATG start codon.
• Incomplete codons at the end of a sequence are ignored.

Incomplete codons at the end of a sequence are ignored.

---

Quick Start (one click)

If you want to try this project immediately:

1. Clone the repository:

git clone https://github.com/marti-dotcom/DNA-Translation.git

2. Navigate to the folder:

cd DNA-Translation

3. Run the script as shown above.

---

Thank you for checking out my DNA to Protein Translation project!

I hope you find it useful and easy to run. Feel free to STAR the repo if you like it!

Made with <3 by Martina